EnrichRBP.filesOperation =================================================== .. py:function:: EnrichRBP.filesOperation.read_fasta_file(fasta_file='') This function is used to read a sequence file in `fasta` format in the following form. :: >hsa_circ_0000005 start:16578,end:16712 AGGCGTGGCTACTGCGGCTGGAGCTGCGATGAGACTCGGAACTCCTCGTCTTACTTTGTGCTCCATGTTTTGTTTTTGTATTTTGGTTTGTAAATTTGTAG >hsa_circ_0000023 start:50,end:174 ACCCTTTCTGCCAGCCAGCTAGCCAGGGCCCAGAAACAAACACCGATGGCTTCTTCCCCACGTCCCAAGATGGATGCAATCTTAACTGAGGCCATTAAGGC >hsa_circ_0000038 start:189,end:318 CCGTCCCCCCCACTGCCTACTCATATACCTCCAGAGCCTCCACGCACCCCTCCATTCCCTGCTAAGACTTTTCAAGTTGTGCCAGAAATTGAGTTTCCACC :Parameters: .. class:: fasta_file:str, default='' Path to the fasta file (absolute path). :Attributes: .. class:: seqslst:list The list used to store sequences from fasta file. .. py:function:: EnrichRBP.fileOperation.read_label(label_file='') This function is used to read a label file in `txt` format in the following form. :: 0 1 1 0 0 :Parameters: .. class:: label_file:str, default='' Path to the label file (absolute path). :Attributes: .. class:: label_ls:list The list used to store labels according to the sequences. It will be transformed to array when the function returns.